Non-Organic-Based Isolation of Mammalian microRNA
Posted: Tue 19 Jul 2016 14:56Non-Organic-Based Isolation of Mammalian microRNA using Norgen’s microRNA Purification Kit
NORGEN - Biotech Corporation
Application Note 13 - RNA Sample Preparation
INTRODUCTION
Small RNAs that are non-protein-coding have attracted much attentions in recent years for their role in regulating gene expression in signaling pathways, cell death, organ development and metabolism (1,2). Moreover, increasing evidence has suggested the involvement of small RNAs in human disease including cancer pathogenesis and viralrelated infections (3). In eukaryotes, regulatory small RNAs are divided into two main classes; (a) small interfering RNAs (siRNAs) which are double-stranded RNA of ~20-25 nucleotides that are involved in RNA interference, and (b) microRNAs (miRNAs) which are single-stranded RNA of ~ 21-23 nucleotides in length that contain complementary sequences to the 3’ untranslated ; regions of the target messenger RNAs (mRNA). Two types of small RNAs are also found in prokaryotes such as E coli (4); (a) RNA-binding small RNAs that act by basepairing with target mRNA, and (b) protein-binding small RNAs that interact with translational regulator proteins.
Unlike larger DNA or RNA molecules, small RNAs are subjected to significant loss in traditional isolation methods that involve alcohol precipitation. Moreover, some available commercial products involve the use of organic extraction which is hazardous and time-consuming. Therefore, there is a great need for a simple and convenient method for the isolation and purification of small RNAs.
Norgen’s microRNA Purification Kit provides an innovative and rapid method for the isolation and purification of microRNA and small RNA from cultured animal cells, tissues, bacteria and plants. The procedure is based on spin column chromatography, using Norgen’s proprietary resin as the separation matrix. The purified RNA can be used in a number of downstream applications including real time PCR, reverse transcription PCR, Northern blotting, and expression array analysis.
In this application note, Norgen’s microRNA Purification Kit is used to isolate microRNA from HeLa cells. Furthermore, the downstream application of RT-PCR is performed, indicating the purity and applicability of the purified RNA.
METHODS AND MATERIALS
microRNA Isolation
microRNA was isolated from 5 x 105 HeLa cells using Norgen’s microRNA Purification Kit as per the provided protocol. Briefly, the cells were pelleted by centrifugation, the media removed, and the pellet washed once with PBS. Lysis solution was then added to the cell pellet, followed by the addition of ethanol. The lysate was then loaded onto a provided Large RNA Removal Column and the flowthrough, containing the microRNAs, was collected. Additional ethanol was added to the flowthrough, and then the lysate-ethanol mix was loaded onto a provided microRNA Enrichment Column. The column was then washed three times with 400 μL of the Wash Solution. The purified microRNA was eluted with 50 μL (or as little as 20 μL) of Elution Buffer. The large RNA that was ;bound to the Large RNA Removal Column was also eluted using 50 μL of the Elution Buffer. microRNA isolation using a competitor’s kit was also performed in parallel using the same amount of HeLa cells for the input.
RNA Gel Electrophoresis
The purified RNA (from both the Large RNA Removal Column and microRNA Enrichment Column) was run on 1.8% formaldehyde-agarose gels for visual inspection of large RNA removal in the microRNA fraction. Generally, 10 μL of each 50 μL elution was run on the gel. The purified microRNA (Norgen’s and the competitor’s) were also resolved on an 8% Urea-PAGE gel for visual comparison.
Capillary Electrophoresis
The purified RNA fractions were loaded onto an Agilent® RNA Nano 6000 chip and resolved on an Agilent® 2100 BioAnalyzer according to the manufacturer’s instructions. Total HeLa cell RNA isolated using Norgen’s Total RNA Isolation Kit was used as a control.
RT-PCR Assay
The microRNA fractions purified from HeLa cells were modified according to (5) for RT-PCR. Briefly, the purified microRNAs were polyadenylated by Poly(A) Polymerase at 37oC for 1 hour. The tailed RNAs were then purified using Norgen’s RNA Cleanup and Concentration Kit as per the provided protocol. First-strand cDNA synthesis was performed using Invitrogen’s Superscript II system and a poly(T) adaptor primer (5). The cDNAs were then used as the template in PCR reactions. For miRNA amplification, primers specific for the human miR-21 (5’CGTGACGTTAGCTTATCAGACTG 3’) and the adaptor (according to (5)) were used. Also, 5S rRNA (Forward Primer 5’ GCCATACCACCCTGAACG 3’; Reverse Primer 5’ AGCCTACAGCACCCGGTATT 3’) amplification was used as internal control.
RESULTS AND DISCUSSION
microRNA was isolated in duplicate from 5 x 105 HeLa cells using Norgen’s microRNA Purification Kit as per the provided protocol. The entire protocol was completed in 20 minutes. A commercially available competitor’s microRNA isolation kit was used in parallel for comparison. In contrast to Norgen’s kit, the time needed to complete the competitor’s protocol was over 40 minutes. Once the RNA samples were isolated, they were run on a urea-PAGE gel for visual inspection. As can be seen in Figure 1, the small RNAs purified by Norgen’s protocol were of a high quality, with no signs of degradation of the major rRNA or tRNA species. More importantly, Norgen’s kit truly isolated only RNA with a size of <200 nucleotides (Fig. 1, Lanes 3 and 4). Only the three major rRNA and tRNA bands are present on the gel, with no other contaminating bands. In contrast, RNA isolated by the competitor’s kit contained some RNA species that were over 200 nucleotides in size (Fig. 1, Lanes 1 and 2). This is of particular significance as most small regulatory RNAs are in the size range of 15 to 30 nucleotides. Thus, Norgen’s kit offers a quick, nonorganic-based method to isolate high quality small RNA that is truly less than 200 nucleotides in size.
Figure 1. Isolate True microRNA using Norgen’s Kit microRNA was isolated from 5 x 105 HeLa cells using Norgen’s microRNA Purification Kit (Lanes 3 and 4) and a competitor’s kit (Lanes 1 and 2). Samples of the purified small RNA were run on an 8% urea-PAGE gel. Lane M is Norgen’s 100b RNA Ladder.
The quality of small RNAs isolated by Norgen’s microRNA Purification Kit was further demonstrated by agarose-gel electrophoresis and capillary gel electrophoresis (Figures 2 and 3). Figure 2 shows that in formaldehyde-agarose gel electrophoresis, the eluted small RNAs (Lanes 3 and 4) are deprived of large RNAs including the major 28S and 18S rRNA (Lane 1 and 2, eluted from Large RNA Removal Column). Similar results were obtained when the RNAs was resolved on an Agilent® Lab-On-A-Chip (Figure 3). Panel A in Figure 3 is an electropherograms of total RNA isolated from HeLa cells using Norgen’s Total RNA Purification Kit, and acted as a control. All the RNA species, including microRNA, 18S rRNA and 28S rRNA can be seen. Panel B in Figure 3 shows the 28S and 18S rRNA that is removed using the Large RNA Removal Columns, while Panel C in Figure 3 shows the microRNA that is isolated using Norge’s microRNA Purification Kit. Clearly, no microRNA is being lost during the large RNA removal step (Panel B), and all the large RNA species have been completely removed and only the microRNA is being recovered in the final elution (Panel C).
Figure 2. Efficient Removal of Large RNA Species. Norgen’s microRNA Purification Kit was used to isolate small RNA species from HeLa cells. The RNA was eluted from both the Large RNA Removal Column (Lanes 1 and 2) and the microRNA Enrichment Column (Lanes 3 and 4), and run on a 1.8% formaldehyde-agarose gel to visualize the RNA species. The large RNA species are being removed with no contaminating large RNA present in the microRNA elution. Lane M is Norgen’s 1 kb RNA Ladder.
Figure 3. Efficient Removal of Large RNA Species. Different RNA species were isolated from HeLa cells, resolved on an Agilent® Lab-On-A-Chip and electropherograms were generated. Panel A contains all the RNA species present in HeLa cells as isolated with Norgen’s Total RNA Kit, and acts as a control. Panel B and C contain RNA that was isolated using Norgen’s microRNA Purification Kit. Panel B shows the large RNA species removed using the Large RNA Removal Columns, and no microRNA can be detected. Panel C shows the microRNA that is isolated using the microRNA Enrichment Columns, and shows that there is no contamination of the microRNA with any large RNA species.
Furthermore, the results in Figure 3 Panel C show the compatibility of the small RNAs isolated with Norgen’s microRNA Purification Kit with a bioanalyzer. This provides an added benefit for quantifying the isolated microRNA, as spectrophotometry may not be applicable for quantifying the small RNA, particularly when low input amounts are used.
In order to assess the applicability of the isolated RNA, RT-PCR was performed. Unlike regular RT-PCR, the amplification and detection of small RNA molecules such as miRNA requires the addition of an adaptor. One of the commonly-used protocols involves the addition of a poly(A) tail to the miRNA by Poly(A) Polymerase (5). This method was used, and Figure 4 (Panel A) shows the amplification of the miR-21 transcript from small RNAs isolated by Norgen’s microRNA Purification Kit. The PCR product of 69 bp (miRNA transcript size = 23 nucleotides and adaptor size = 46 nucleotides) was detected in both the small RNA fractions (Lanes 2 and 3) as well as the total RNA control isolated using Norgen’s Total RNA Purification Kit (Lane 1). Similarly, the 5S rRNA (Figure 4, Panel B), which is commonly used as a loading control for miRNA RT-PCR, was amplified from the purified small RNA. This suggested that the small RNA isolated was of a high purity and had retained it’s biological activity.
Figure 4. RT-PCR Results for microRNA Isolated Using Norgen’s Kit. Panel A shows the amplification of the miR-21 transcript from small RNAs while Panel B shows the 5S rRNA amplification from small RNAs. Lane 1 in both panels shows the results when total RNA isolated from HeLa cells using Norgen’s Total RNA Purification Kit was used as a control. Lanes 2 and 3 contain the successful RT-PCR when the microRNA isolated using Norgen’s microRNA Purifictaion Kit was used as the template, and Lanes 4 contain the nontemplate control. The RT-PCR was successful for both reactions using the microRNA as the template.
CONCLUSION
Through the use of Norgen’s microRNA Purification Kit to isolate small RNA from HeLa cells, a number of conclusions regarding Norgen’s kit can be made:
1. Norgen’s kit allows for the isolation of high quality small RNA within 20 minutes and without the use of any organic solvent. Norgen’s kit protocol requires no organics and has a minimal number of steps, thus providing a more convenient method than some existing commercial kits.
2. Small RNA isolated using Norgen’s kit is of a high purity and integrity. The high quality and integrity of the RNA is demonstrated in Figures 1 to 3. Figure 1 shows that the RNA isolated is truly <200 nucleotides and shows no degradation. Figures 2 and 3 show that Norgen’s kit isolates small RNAs that are free of any large RNA contamination.
3. Norgen’s kit isolates small RNAs, including miRNA that are fully compatible with downstream applications. The compatibility with downstream applications is demonstrated in Figures 3 and 4. Figure 3 shows that the small RNAs can be resolved on a Lab-on-A-Chip, allowing proper quantification of the small RNA. Figure 4 shows that the small RNAs can be modified by enzymes such as Poly(A) Polymerase, and subsequently used for RT-PCR amplification of miRNAs.
REFERENCES
1. Bartel, D.P. 2004. MicroRNAs: Genomics, Biogenesis, Mechanisms and Function. Cell. 116: 281-297.
2. Nilsen, T.W. 2007. Mechanisms of microRNAmediated gene regulation in animal cells. Trends in Genetics. 23: 243-249.
3. Zhang, B., Wang, Q., and Pan, X. 2007. MicroRNAs and their regulatory roles in animals and plants. Journal of Cellular Physiology. 210: 279-289.
4. Majdalani, N., Vanderpool, C.K., and Gottesman, S. 2005. Bacterial small RNA regulators. Critical Reviews in Biochemistry and Molecular Biology. 40: 93-113.
5. Shi, R., and Chiang, V.L. Facile means for quantifying microRNA expression by real-time PCR. Biotechniques. 39: 519-524.
NORGEN - Biotech Corporation
Application Note 13 - RNA Sample Preparation
INTRODUCTION
Small RNAs that are non-protein-coding have attracted much attentions in recent years for their role in regulating gene expression in signaling pathways, cell death, organ development and metabolism (1,2). Moreover, increasing evidence has suggested the involvement of small RNAs in human disease including cancer pathogenesis and viralrelated infections (3). In eukaryotes, regulatory small RNAs are divided into two main classes; (a) small interfering RNAs (siRNAs) which are double-stranded RNA of ~20-25 nucleotides that are involved in RNA interference, and (b) microRNAs (miRNAs) which are single-stranded RNA of ~ 21-23 nucleotides in length that contain complementary sequences to the 3’ untranslated ; regions of the target messenger RNAs (mRNA). Two types of small RNAs are also found in prokaryotes such as E coli (4); (a) RNA-binding small RNAs that act by basepairing with target mRNA, and (b) protein-binding small RNAs that interact with translational regulator proteins.
Unlike larger DNA or RNA molecules, small RNAs are subjected to significant loss in traditional isolation methods that involve alcohol precipitation. Moreover, some available commercial products involve the use of organic extraction which is hazardous and time-consuming. Therefore, there is a great need for a simple and convenient method for the isolation and purification of small RNAs.
Norgen’s microRNA Purification Kit provides an innovative and rapid method for the isolation and purification of microRNA and small RNA from cultured animal cells, tissues, bacteria and plants. The procedure is based on spin column chromatography, using Norgen’s proprietary resin as the separation matrix. The purified RNA can be used in a number of downstream applications including real time PCR, reverse transcription PCR, Northern blotting, and expression array analysis.
In this application note, Norgen’s microRNA Purification Kit is used to isolate microRNA from HeLa cells. Furthermore, the downstream application of RT-PCR is performed, indicating the purity and applicability of the purified RNA.
METHODS AND MATERIALS
microRNA Isolation
microRNA was isolated from 5 x 105 HeLa cells using Norgen’s microRNA Purification Kit as per the provided protocol. Briefly, the cells were pelleted by centrifugation, the media removed, and the pellet washed once with PBS. Lysis solution was then added to the cell pellet, followed by the addition of ethanol. The lysate was then loaded onto a provided Large RNA Removal Column and the flowthrough, containing the microRNAs, was collected. Additional ethanol was added to the flowthrough, and then the lysate-ethanol mix was loaded onto a provided microRNA Enrichment Column. The column was then washed three times with 400 μL of the Wash Solution. The purified microRNA was eluted with 50 μL (or as little as 20 μL) of Elution Buffer. The large RNA that was ;bound to the Large RNA Removal Column was also eluted using 50 μL of the Elution Buffer. microRNA isolation using a competitor’s kit was also performed in parallel using the same amount of HeLa cells for the input.
RNA Gel Electrophoresis
The purified RNA (from both the Large RNA Removal Column and microRNA Enrichment Column) was run on 1.8% formaldehyde-agarose gels for visual inspection of large RNA removal in the microRNA fraction. Generally, 10 μL of each 50 μL elution was run on the gel. The purified microRNA (Norgen’s and the competitor’s) were also resolved on an 8% Urea-PAGE gel for visual comparison.
Capillary Electrophoresis
The purified RNA fractions were loaded onto an Agilent® RNA Nano 6000 chip and resolved on an Agilent® 2100 BioAnalyzer according to the manufacturer’s instructions. Total HeLa cell RNA isolated using Norgen’s Total RNA Isolation Kit was used as a control.
RT-PCR Assay
The microRNA fractions purified from HeLa cells were modified according to (5) for RT-PCR. Briefly, the purified microRNAs were polyadenylated by Poly(A) Polymerase at 37oC for 1 hour. The tailed RNAs were then purified using Norgen’s RNA Cleanup and Concentration Kit as per the provided protocol. First-strand cDNA synthesis was performed using Invitrogen’s Superscript II system and a poly(T) adaptor primer (5). The cDNAs were then used as the template in PCR reactions. For miRNA amplification, primers specific for the human miR-21 (5’CGTGACGTTAGCTTATCAGACTG 3’) and the adaptor (according to (5)) were used. Also, 5S rRNA (Forward Primer 5’ GCCATACCACCCTGAACG 3’; Reverse Primer 5’ AGCCTACAGCACCCGGTATT 3’) amplification was used as internal control.
RESULTS AND DISCUSSION
microRNA was isolated in duplicate from 5 x 105 HeLa cells using Norgen’s microRNA Purification Kit as per the provided protocol. The entire protocol was completed in 20 minutes. A commercially available competitor’s microRNA isolation kit was used in parallel for comparison. In contrast to Norgen’s kit, the time needed to complete the competitor’s protocol was over 40 minutes. Once the RNA samples were isolated, they were run on a urea-PAGE gel for visual inspection. As can be seen in Figure 1, the small RNAs purified by Norgen’s protocol were of a high quality, with no signs of degradation of the major rRNA or tRNA species. More importantly, Norgen’s kit truly isolated only RNA with a size of <200 nucleotides (Fig. 1, Lanes 3 and 4). Only the three major rRNA and tRNA bands are present on the gel, with no other contaminating bands. In contrast, RNA isolated by the competitor’s kit contained some RNA species that were over 200 nucleotides in size (Fig. 1, Lanes 1 and 2). This is of particular significance as most small regulatory RNAs are in the size range of 15 to 30 nucleotides. Thus, Norgen’s kit offers a quick, nonorganic-based method to isolate high quality small RNA that is truly less than 200 nucleotides in size.
Figure 1. Isolate True microRNA using Norgen’s Kit microRNA was isolated from 5 x 105 HeLa cells using Norgen’s microRNA Purification Kit (Lanes 3 and 4) and a competitor’s kit (Lanes 1 and 2). Samples of the purified small RNA were run on an 8% urea-PAGE gel. Lane M is Norgen’s 100b RNA Ladder.
The quality of small RNAs isolated by Norgen’s microRNA Purification Kit was further demonstrated by agarose-gel electrophoresis and capillary gel electrophoresis (Figures 2 and 3). Figure 2 shows that in formaldehyde-agarose gel electrophoresis, the eluted small RNAs (Lanes 3 and 4) are deprived of large RNAs including the major 28S and 18S rRNA (Lane 1 and 2, eluted from Large RNA Removal Column). Similar results were obtained when the RNAs was resolved on an Agilent® Lab-On-A-Chip (Figure 3). Panel A in Figure 3 is an electropherograms of total RNA isolated from HeLa cells using Norgen’s Total RNA Purification Kit, and acted as a control. All the RNA species, including microRNA, 18S rRNA and 28S rRNA can be seen. Panel B in Figure 3 shows the 28S and 18S rRNA that is removed using the Large RNA Removal Columns, while Panel C in Figure 3 shows the microRNA that is isolated using Norge’s microRNA Purification Kit. Clearly, no microRNA is being lost during the large RNA removal step (Panel B), and all the large RNA species have been completely removed and only the microRNA is being recovered in the final elution (Panel C).
Figure 2. Efficient Removal of Large RNA Species. Norgen’s microRNA Purification Kit was used to isolate small RNA species from HeLa cells. The RNA was eluted from both the Large RNA Removal Column (Lanes 1 and 2) and the microRNA Enrichment Column (Lanes 3 and 4), and run on a 1.8% formaldehyde-agarose gel to visualize the RNA species. The large RNA species are being removed with no contaminating large RNA present in the microRNA elution. Lane M is Norgen’s 1 kb RNA Ladder.
Figure 3. Efficient Removal of Large RNA Species. Different RNA species were isolated from HeLa cells, resolved on an Agilent® Lab-On-A-Chip and electropherograms were generated. Panel A contains all the RNA species present in HeLa cells as isolated with Norgen’s Total RNA Kit, and acts as a control. Panel B and C contain RNA that was isolated using Norgen’s microRNA Purification Kit. Panel B shows the large RNA species removed using the Large RNA Removal Columns, and no microRNA can be detected. Panel C shows the microRNA that is isolated using the microRNA Enrichment Columns, and shows that there is no contamination of the microRNA with any large RNA species.
Furthermore, the results in Figure 3 Panel C show the compatibility of the small RNAs isolated with Norgen’s microRNA Purification Kit with a bioanalyzer. This provides an added benefit for quantifying the isolated microRNA, as spectrophotometry may not be applicable for quantifying the small RNA, particularly when low input amounts are used.
In order to assess the applicability of the isolated RNA, RT-PCR was performed. Unlike regular RT-PCR, the amplification and detection of small RNA molecules such as miRNA requires the addition of an adaptor. One of the commonly-used protocols involves the addition of a poly(A) tail to the miRNA by Poly(A) Polymerase (5). This method was used, and Figure 4 (Panel A) shows the amplification of the miR-21 transcript from small RNAs isolated by Norgen’s microRNA Purification Kit. The PCR product of 69 bp (miRNA transcript size = 23 nucleotides and adaptor size = 46 nucleotides) was detected in both the small RNA fractions (Lanes 2 and 3) as well as the total RNA control isolated using Norgen’s Total RNA Purification Kit (Lane 1). Similarly, the 5S rRNA (Figure 4, Panel B), which is commonly used as a loading control for miRNA RT-PCR, was amplified from the purified small RNA. This suggested that the small RNA isolated was of a high purity and had retained it’s biological activity.
Figure 4. RT-PCR Results for microRNA Isolated Using Norgen’s Kit. Panel A shows the amplification of the miR-21 transcript from small RNAs while Panel B shows the 5S rRNA amplification from small RNAs. Lane 1 in both panels shows the results when total RNA isolated from HeLa cells using Norgen’s Total RNA Purification Kit was used as a control. Lanes 2 and 3 contain the successful RT-PCR when the microRNA isolated using Norgen’s microRNA Purifictaion Kit was used as the template, and Lanes 4 contain the nontemplate control. The RT-PCR was successful for both reactions using the microRNA as the template.
CONCLUSION
Through the use of Norgen’s microRNA Purification Kit to isolate small RNA from HeLa cells, a number of conclusions regarding Norgen’s kit can be made:
1. Norgen’s kit allows for the isolation of high quality small RNA within 20 minutes and without the use of any organic solvent. Norgen’s kit protocol requires no organics and has a minimal number of steps, thus providing a more convenient method than some existing commercial kits.
2. Small RNA isolated using Norgen’s kit is of a high purity and integrity. The high quality and integrity of the RNA is demonstrated in Figures 1 to 3. Figure 1 shows that the RNA isolated is truly <200 nucleotides and shows no degradation. Figures 2 and 3 show that Norgen’s kit isolates small RNAs that are free of any large RNA contamination.
3. Norgen’s kit isolates small RNAs, including miRNA that are fully compatible with downstream applications. The compatibility with downstream applications is demonstrated in Figures 3 and 4. Figure 3 shows that the small RNAs can be resolved on a Lab-on-A-Chip, allowing proper quantification of the small RNA. Figure 4 shows that the small RNAs can be modified by enzymes such as Poly(A) Polymerase, and subsequently used for RT-PCR amplification of miRNAs.
REFERENCES
1. Bartel, D.P. 2004. MicroRNAs: Genomics, Biogenesis, Mechanisms and Function. Cell. 116: 281-297.
2. Nilsen, T.W. 2007. Mechanisms of microRNAmediated gene regulation in animal cells. Trends in Genetics. 23: 243-249.
3. Zhang, B., Wang, Q., and Pan, X. 2007. MicroRNAs and their regulatory roles in animals and plants. Journal of Cellular Physiology. 210: 279-289.
4. Majdalani, N., Vanderpool, C.K., and Gottesman, S. 2005. Bacterial small RNA regulators. Critical Reviews in Biochemistry and Molecular Biology. 40: 93-113.
5. Shi, R., and Chiang, V.L. Facile means for quantifying microRNA expression by real-time PCR. Biotechniques. 39: 519-524.